Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249361

Morpholino Name: dazap2 MO2
Synonyms: SP-MO
mRNA Target: dazap2

Morpholino Type: uncategorized morpholino
Sequence:
5' GGTACTGTCCTGTAGAAAGGAAAGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GCTTTCCTTTCTACAGGACAGTACC 3' ||||||||||||||||||||||||| 3' CGAAAGGAAAGATGTCCTGTCATGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold133382:4190376..4190400 23/25 Antisense off-target Xelaev16009662m
Scaffold23403:12034172..12034196 22/25 unknown
Scaffold220448:3250720..3250744 21/25 unknown
Scaffold52441:11311351..11311375 21/25 unknown
tropicalis 7.1 scaffold_2:85834872..85834896 25/25 Antisense target dazap2
Publications
First: Dazap2 is required for FGF-mediated posterior neural patterning, independent of Wnt and Cdx function., Dev Biol 2009                                
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556