Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249362

Morpholino Name: dbf4 MO1
Synonyms: XDMO2
mRNA Target: dbf4

Morpholino Type: uncategorized morpholino
Sequence:
5' CCATGTGTTCCTCGGTTTCTGTGCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold19259:2291498..2291522 22/25 Sense off-target Xelaev16024358m
Scaffold75398:1817527..1817551 21/25 unknown
tropicalis 7.1 scaffold_3:57102926..57102950 21/25 unknown
Publications
First: A vertebrate homolog of the cell cycle regulator Dbf4 is an inhibitor of Wnt signaling required for heart development., Dev Cell 2005    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556