Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249363

Morpholino Name: dbf4 MO2
Synonyms: XDMO1
mRNA Target: dbf4

Morpholino Type: uncategorized morpholino
Sequence:
5' CACTGCTGCTATGGTAGATTTCATT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' AATGAAATCTACCGTAGCAGCAGTG 3' ||||||||||||| ||||||||||| 3' TTACTTTAGATGGTATCGTCGTCAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold61124:845007..845031 24/25 Antisense target dbf4.L
Scaffold404268:505929..505953 22/25 unknown
tropicalis 7.1 scaffold_104:257515..257539 21/25 unknown
scaffold_2:112685404..112685428 21/25 unknown
scaffold_9:70766342..70766366 21/25 unknown
Publications
First: A vertebrate homolog of the cell cycle regulator Dbf4 is an inhibitor of Wnt signaling required for heart development., Dev Cell 2005    
Most recent: Chk1 Inhibition of the Replication Factor Drf1 Guarantees Cell-Cycle Elongation at the Xenopus laevis Mid-blastula Transition., Dev Cell 2017                  
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556