Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249364

Morpholino Name: dbx1 MO1
Synonyms: XDbx1 MO
mRNA Target: dbx1

Morpholino Type: uncategorized morpholino
Sequence:
5' GAGCTAAGAGGCTTGGGAACATCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/24 24/24
genomic

MO
5' TGATGTTCCCAAGCCTGTTAGCCC 3' |||||||||||||||| ||||| | 3' ACTACAAGGGTTCGGAGAATCGAG 5' 5' TGATGTTCCCAAGCCTCTTAGCTC 3' |||||||||||||||||||||||| 3' ACTACAAGGGTTCGGAGAATCGAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold93786:2555253..2555276 24/24 Antisense target dbx1.S
Scaffold25194:5695065..5695088 23/24 Antisense off-target Xelaev16033714m
tropicalis 7.1 scaffold_4:1219413..1219436 22/24 Antisense target dbx1
scaffold_2:8778751..8778774 20/24 unknown
Publications
First: Xenopus Dbx2 is involved in primary neurogenesis and early neural plate patterning., Biochem Biophys Res Commun 2011              
Most recent: Prdm12 specifies V1 interneurons through cross-repressive interactions with Dbx1 and Nkx6 genes in Xenopus., Development 2015                                      
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556