Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249365

Morpholino Name: dbx2 MO1
Synonyms: XDbx2 MO
mRNA Target: dbx2

Morpholino Type: uncategorized morpholino
Sequence:
5' ACTTCTGATTCTGGTCTGGCTCCTA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold30470:4340208..4340232 25/25 Antisense off-target Xelaev16041127m
Scaffold23403:12049589..12049613 22/25 unknown
Scaffold82610:163210..163234 22/25 unknown
Scaffold159240:481375..481399 21/25 Sense off-target Xelaev16016997m
Scaffold226594:789371..789395 21/25 unknown
Scaffold54140:111169..111193 21/25 unknown
Scaffold98502:352938..352962 21/25 unknown
tropicalis 7.1 scaffold_5:52751747..52751771 21/25 unknown
scaffold_82:348886..348910 21/25 unknown
Publications
First: Xenopus Dbx2 is involved in primary neurogenesis and early neural plate patterning., Biochem Biophys Res Commun 2011              
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556