Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249366

Morpholino Name: dcc MO1
Synonyms: XDCC-MO, xDCC
mRNA Target: dcc

Morpholino Type: uncategorized morpholino
Sequence:
5' CCAAGACAATTCTCCATATTTCAGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold21588:287542..287566 25/25 unknown
Scaffold40738:240442..240466 25/25 unknown
Scaffold107347:416364..416388 21/25 Antisense off-target Xelaev16001969m
Scaffold109184:2222546..2222570 21/25 unknown
Scaffold124774:748507..748531 21/25 unknown
Scaffold160841:1258805..1258829 21/25 unknown
Scaffold84188:1551549..1551573 21/25 Antisense off-target Xelaev16075818m
Scaffold96712:1439626..1439650 21/25 unknown
tropicalis 7.1 scaffold_1:10313194..10313218 24/25 unknown
scaffold_1:20610711..20610735 21/25 Sense off-target prlr
scaffold_2:115190353..115190377 21/25 unknown
Publications
First: Peptidyl-prolyl isomerase FKBP52 controls chemotropic guidance of neuronal growth cones via regulation of TRPC1 channel opening., Neuron 2009  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556