Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249376

Morpholino Name: dicer1 MO1
Synonyms: xdcr-mo1
mRNA Target: dicer1

Morpholino Type: uncategorized morpholino
Sequence:
5' CAAAATGCAGGGCTTTCATAAATCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genomic

MO
5' GGATTTATGAGAGCCCTGCATTTTG 3' |||||||||| |||||||||||||| 3' CCTAAATACTTTCGGGACGTAAAAC 5' 5' GGATTTATGAAAGCCCTGCATTTTG 3' ||||||||||||||||||||||||| 3' CCTAAATACTTTCGGGACGTAAAAC 5' 5' GGATTTATGAAAGCCCTGCATTTTG 3' ||||||||||||||||||||||||| 3' CCTAAATACTTTCGGGACGTAAAAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:66076151..66076175 25/25 Antisense target dicer1.L
chr8S:19777821..19777845 25/25 Antisense target dicer1.S
chr1S:150231746..150231770 21/25 Antisense off-target LOC108705294 [provisional:fam172a]
chr3L:80825853..80825877 21/25 Antisense off-target pstpip1.L
chr4L:38590087..38590111 21/25 Antisense off-target bcar1.L
chr9_10L:67153056..67153080 21/25 Antisense off-target pde11a.L
chr1S:30546365..30546389 21/25 unknown
chr2S:43145918..43145942 21/25 unknown
chr4L:139510988..139511012 21/25 unknown
tropicalis 10.0 Chr8:88609196..88609220 24/25 Antisense target dicer1
Chr7:5857138..5857162 21/25 Sense off-target rab11fip2
Publications
First: Dicer inactivation causes heterochronic retinogenesis in Xenopus laevis., Int J Dev Biol 2008                  
Most recent: Dicer inactivation stimulates limb regeneration ability in Xenopus laevis., Wound Repair Regen 2018            
View All Papers