Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249377

Morpholino Name: dicer1 MO2
Synonyms: xdcr-mo2
mRNA Target: dicer1

Morpholino Type: uncategorized morpholino
Sequence:
5' ATGAAGATCCTCTGATGGCACTTGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TCAAGTGCCATCAGAGGATCTTCAT 3' ||||||||||||||||||||||||| 3' AGTTCACGGTAGTCTCCTAGAAGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8S:19775451..19775475 25/25 Antisense target dicer1.S
Publications
First: Dicer inactivation causes heterochronic retinogenesis in Xenopus laevis., Int J Dev Biol 2008                  
Most recent:
View All Papers