Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249378

Morpholino Name: dicer1 MO3
Synonyms: Dicer MO1
mRNA Target: dicer1

Morpholino Type: uncategorized morpholino
Sequence:
5' GGCCTGCCATGCTGAGGGTCTGCAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 23/25 25/25
genomic

MO
5' TTGCAGACCCTCAGCATGGCAGGCC 3' ||||||||||||||||||||||||| 3' AACGTCTGGGAGTCGTACCGTCCGG 5' 5' TTGCAGTCCCTCAGCATGGCAGGAC 3' |||||| |||||||||||||||| | 3' AACGTCTGGGAGTCGTACCGTCCGG 5' 5' TTGCAGACCCTCAGCATGGCAGGCC 3' ||||||||||||||||||||||||| 3' AACGTCTGGGAGTCGTACCGTCCGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8S:19777843..19777867 25/25 Antisense target dicer1.S
chr8L:66076129..66076153 23/25 Antisense target dicer1.L
chr9_10L:51405831..51405855 22/25 Antisense off-target dnajb2.L
Scaffold20:691937..691961 21/25 Antisense off-target kank2.S
chr2L:162684432..162684456 21/25 Antisense off-target yap1.L
chr1L:162662757..162662781 21/25 Antisense off-target mlxip.L
chr6L:81456420..81456444 21/25 unknown
tropicalis 10.0 Chr8:88609174..88609198 25/25 Antisense target dicer1
Publications
First: FMR1/FXR1 and the miRNA pathway are required for eye and neural crest development., Dev Biol 2010                                                                
Most recent:
View All Papers