Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249379

Morpholino Name: dicer1 MO4
Synonyms: Dicer MO2
mRNA Target: dicer1

Morpholino Type: uncategorized morpholino
Sequence:
5' GAGTCATGAGCTGAAGGCCTGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25 25/25
genomic

MO
5' ATGGCAGGCCTTCAGCTCATGACTC 3' ||||||||||||||||||||||||| 3' TACCGTCCGGAAGTCGAGTACTGAG 5' 5' ATGGCAGGACTTCAGCTCATGACTC 3' |||||||| |||||||||||||||| 3' TACCGTCCGGAAGTCGAGTACTGAG 5' 5' ATGGCAGGCCTTCAGCTCATGACTC 3' ||||||||||||||||||||||||| 3' TACCGTCCGGAAGTCGAGTACTGAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8S:19777858..19777882 25/25 Antisense target dicer1.S
chr8L:66076114..66076138 24/25 Antisense target dicer1.L
tropicalis 10.0 Chr8:88609159..88609183 25/25 Antisense target dicer1
Chr5:41326157..41326181 21/25 unknown
Publications
First: FMR1/FXR1 and the miRNA pathway are required for eye and neural crest development., Dev Biol 2010                                                                
Most recent:
View All Papers