Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249380

Morpholino Name: dicer1 MO5
Synonyms: Dicer-MO
mRNA Target: dicer1

Morpholino Type: uncategorized morpholino
Sequence:
5' TGCAGGGCTTTCATAAATCCAGTGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genomic

MO
5' TCACTGGATTTATGAGAGCCCTGCA 3' ||||||||||||||| ||||||||| 3' AGTGACCTAAATACTTTCGGGACGT 5' 5' TCACTGGATTTATGAAAGCCCTGCA 3' ||||||||||||||||||||||||| 3' AGTGACCTAAATACTTTCGGGACGT 5' 5' TCACTGGATTTATGAAAGCCCTGCA 3' ||||||||||||||||||||||||| 3' AGTGACCTAAATACTTTCGGGACGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:66076156..66076180 25/25 Antisense target dicer1.L
chr8S:19777816..19777840 25/25 Antisense target dicer1.S
chr5L:45387147..45387171 21/25 Sense off-target birc6.L
chr1S:47928483..47928507 21/25 unknown
chr6L:122727980..122728004 21/25 unknown
tropicalis 10.0 Chr8:88609201..88609225 24/25 Antisense target dicer1
Chr10:29378749..29378773 21/25 unknown
Publications
First: The miR-30 miRNA family regulates Xenopus pronephros development and targets the transcription factor Xlim1/Lhx1., Development 2009                
Most recent: MicroRNAs are critical regulators of tuberous sclerosis complex and mTORC1 activity in the size control of the Xenopus kidney., Proc Natl Acad Sci U S A 2014                                                            
View All Papers