Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249383

Morpholino Name: dlc MO2
Synonyms: Delta-2 MO1, X-Delta-2 MO1, X-delta-2
mRNA Target: dlc

Morpholino Type: uncategorized morpholino
Sequence:
5' CATGGCAGTCTCCTGGCACTGACAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TTGTCAGTGCCAGGAGACTGCCATG 3' ||||||||||||||||||||||||| 3' AACAGTCACGGTCCTCTGACGGTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold39723:7071902..7071926 25/25 Antisense target dlc.L
Scaffold3586:2874265..2874289 21/25 unknown
Scaffold52441:8248514..8248538 21/25 Antisense off-target Xelaev16060183m
tropicalis 7.1 scaffold_1:105243016..105243040 21/25 unknown
Publications
First: Role of X-Delta-2 in the early neural development of Xenopus laevis., Dev Dyn 2006                                                
Most recent: Perturbation of Notch/Suppressor of Hairless pathway disturbs migration of primordial germ cells in Xenopus embryo., Dev Growth Differ 2010  
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556