Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249384

Morpholino Name: dll1 MO1
Synonyms: Delta1 MO
mRNA Target: dll1

Morpholino Type: uncategorized morpholino
Sequence:
5' CGCTGCTGTCCCATGTTGTCTGATA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 25/25
genomic

MO
5' TATCAGCCAACATGGGACAGCAATG 3' |||||| ||||||||||||||| | 3' ATAGTCTGTTGTACCCTGTCGTCGC 5' 5' TATCAGACAACATGGGACAGCAGCG 3' ||||||||||||||||||||||||| 3' ATAGTCTGTTGTACCCTGTCGTCGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold176005:342508..342532 25/25 Antisense target dll1.L
Scaffold34423:1998520..1998544 23/25 Antisense off-target Xelaev16045005m
Scaffold114601:314337..314361 21/25 unknown
tropicalis 7.1 scaffold_5:73331323..73331347 22/25 Antisense target dll1
Publications
First: Hairy2 functions through both DNA-binding and non DNA-binding mechanisms at the neural plate border in Xenopus., Dev Biol 2008                          
Most recent: Self-regulation of Stat3 activity coordinates cell-cycle progression and neural crest specification., EMBO J 2010  
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556