Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249385

Morpholino Name: dll1 MO2
Synonyms: XDelta1, Xdelta1 MO
mRNA Target: dll1

Morpholino Type: uncategorized morpholino
Sequence:
5' GCGCTGCTGTCCCATGTTGTCTGAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 25/25
genomic

MO
5' ATCAGCCAACATGGGACAGCAATGC 3' ||||| ||||||||||||||| || 3' TAGTCTGTTGTACCCTGTCGTCGCG 5' 5' ATCAGACAACATGGGACAGCAGCGC 3' ||||||||||||||||||||||||| 3' TAGTCTGTTGTACCCTGTCGTCGCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold176005:342507..342531 25/25 Antisense target dll1.L
Scaffold34423:1998521..1998545 23/25 Antisense off-target Xelaev16045005m
Scaffold59267:273187..273211 21/25 Antisense off-target pdlim2.S
Scaffold7281:2138542..2138566 21/25 unknown
tropicalis 7.1 scaffold_5:73331322..73331346 22/25 Antisense target dll1
scaffold_3:115268321..115268345 21/25 unknown
Publications
First: Antagonistic role of XESR1 and XESR5 in mesoderm formation in Xenopus laevis., Int J Dev Biol 2011            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556