Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249386

Morpholino Name: dll1 MO3
Synonyms: X-delta-1
mRNA Target: dll1

Morpholino Type: uncategorized morpholino
Sequence:
5' GCTCTGCTGTCCCATGTTGTCTGAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 24/25
genomic

MO
5' ATCAGCCAACATGGGACAGCAATGC 3' ||||| ||||||||||||||| || 3' TAGTCTGTTGTACCCTGTCGTCTCG 5' 5' ATCAGACAACATGGGACAGCAGCGC 3' |||||||||||||||||||||| || 3' TAGTCTGTTGTACCCTGTCGTCTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold176005:342507..342531 24/25 Antisense target dll1.L
Scaffold34423:1998521..1998545 23/25 Antisense off-target Xelaev16045005m
Scaffold106356:999729..999753 21/25 Sense off-target crmp1.L
Scaffold50694:5156514..5156538 21/25 Sense off-target atp11c.S
Scaffold59267:273187..273211 21/25 Antisense off-target pdlim2.S
tropicalis 7.1 scaffold_5:73331322..73331346 22/25 Antisense target dll1
scaffold_1:13638346..13638370 21/25 unknown
Publications
First: Perturbation of Notch/Suppressor of Hairless pathway disturbs migration of primordial germ cells in Xenopus embryo., Dev Growth Differ 2010  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556