Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249390

Morpholino Name: dmrta2 MO1
Synonyms: Dmrt5
mRNA Target: dmrta2

Morpholino Type: uncategorized morpholino
Sequence:
5' ACCATTCAGCTCCATTGTACAGTTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 24/25
genomic

MO
5' CGATTGTAGAATGGAGCTGAATGGT 3' | | |||| |||||||||||||||| 3' GTTGACATGTTACCTCGACTTACCA 5' 5' CAACTCTACAATGGAGCTGAATGGT 3' ||||| ||||||||||||||||||| 3' GTTGACATGTTACCTCGACTTACCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4S:69692836..69692860 24/25 Antisense target dmrta2.S
chr4L:85758964..85758988 22/25 Antisense target dmrta2.L
chr9_10L:66653391..66653415 21/25 Sense off-target ola1.L
chr3S:78845765..78845789 22/25 unknown
tropicalis 10.0 Chr1:207512054..207512078 22/25 Sense off-target setbp1
Publications
First: The Xenopus doublesex-related gene Dmrt5 is required for olfactory placode neurogenesis., Dev Biol 2013                                
Most recent:
View All Papers