Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249391

Morpholino Name: dnah5 MO1
Synonyms: dnah5-SB-MO
mRNA Target: dnah5

Morpholino Type: uncategorized morpholino
Sequence:
5' TGTACAGACCTGATTACCCTCTAGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' TCTAGAGGGTAATCAGGTCTGTAAC 3' ||||||||||||||||||||||| 3' AGATCTCCCATTAGTCCAGACATGT 5' 5' TCTAGAGGGTAATCAGGTCTGTACA 3' ||||||||||||||||||||||||| 3' AGATCTCCCATTAGTCCAGACATGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold113027:575787..575811 25/25 Antisense target dnah5.S
tropicalis 7.1 scaffold_6:69911000..69911024 23/25 Antisense target dnah5
scaffold_5:19000182..19000206 21/25 unknown
Publications
First: Flow on the right side of the gastrocoel roof plate is dispensable for symmetry breakage in the frog Xenopus laevis., Dev Biol 2009                                          
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556