Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249392

Morpholino Name: dnah9 MO1
Synonyms: dnah9
mRNA Target: dnah9

Morpholino Type: uncategorized morpholino
Sequence:
5' TGGGTCACTCATCTTTCCCCTCATT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold263386:908836..908860 21/25 unknown
Scaffold42960:4825077..4825101 21/25 unknown
Scaffold50094:225650..225674 21/25 Sense off-target Xelaev16058319m
tropicalis 7.1 scaffold_10:23513590..23513614 25/25 unknown
scaffold_10:3049192..3049216 25/25 unknown
scaffold_10:5618079..5618103 25/25 Antisense off-target mmp24
scaffold_2:145143139..145143163 25/25 unknown
scaffold_2:148496006..148496030 25/25 unknown
scaffold_2791:5678..5702 25/25 unknown
scaffold_3:2388032..2388056 25/25 unknown
scaffold_4:1664603..1664627 25/25 unknown
scaffold_6:802601..802625 25/25 unknown
scaffold_8:4480763..4480787 25/25 unknown
scaffold_9:1396272..1396296 25/25 unknown
scaffold_9:2111436..2111460 25/25 unknown
scaffold_9:2825070..2825094 25/25 unknown
scaffold_9:5836535..5836559 25/25 Sense off-target acmsd
scaffold_9:6097532..6097556 24/25 unknown
scaffold_230:126994..127018 21/25 unknown
Publications
First: Rare copy number variations in congenital heart disease patients identify unique genes in left-right patterning., Proc Natl Acad Sci U S A 2011                        
Most recent: Leftward Flow Determines Laterality in Conjoined Twins., Curr Biol 2017                  
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556