Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249394

Morpholino Name: dnah9 MO3
Synonyms: dnah9-AUG-MO
mRNA Target: dnah9

Morpholino Type: uncategorized morpholino
Sequence:
5' GGTCACGTTTTGGAGGTGCAGTGGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GCCACTGCACCTCCAAAACGTGACC 3' ||||||||||||||||||||||||| 3' CGGTGACGTGGAGGTTTTGCACTGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold163806:1007360..1007384 25/25 Antisense target dnah9.S
tropicalis 7.1 scaffold_1:10633316..10633340 21/25 unknown
Publications
First: Flow on the right side of the gastrocoel roof plate is dispensable for symmetry breakage in the frog Xenopus laevis., Dev Biol 2009                                          
Most recent: Leftward Flow Determines Laterality in Conjoined Twins., Curr Biol 2017                  
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556