Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249396

Morpholino Name: dnal1 MO1
Synonyms: TGas030a23, XtLueRDLC, aD1LC
mRNA Target: dnal1

Morpholino Type:
Sequence:
5' CTTTAATGGTTGTTGCTTTTGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 21/25
genomic

MO
5' CAGGCAAAAGCAACAACCATTAAAG 3' ||||||||||||||||||||||| 3' TACCGTTTTCGTTGTTGGTAATTTC 5' 5' CAGGCAAAAGCAACAACCATAAAGG 3' |||||||||||||||||| || | 3' TACCGTTTTCGTTGTTGGTAATTTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold15436:4970845..4970869 22/25 unknown
Scaffold42960:6519945..6519969 22/25 unknown
Scaffold122663:1791688..1791712 21/25 Antisense off-target Xelaev16006248m
Scaffold161773:227441..227465 21/25 unknown
Scaffold231676:838490..838514 21/25 unknown
Scaffold239078:29664..29688 21/25 Antisense off-target Xelaev16031814m
Scaffold37038:1182386..1182410 21/25 unknown
Scaffold91950:2060255..2060279 21/25 Antisense target dnal1.L
tropicalis 7.1 scaffold_8:84573290..84573314 23/25 Antisense target dnal1
scaffold_1:197052520..197052544 21/25 unknown
scaffold_3:77406173..77406197 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556