Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249405

Morpholino Name: dnmt1 MO1
Synonyms: xDMO, xDnmt1 morpholino, xDnmt1a
Target mRNA: dnmt1

Morpholino Type: uncategorized morpholino
Sequence: 5' GGACAGGCGTGAAACAGACTCGGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/24
genomic

MO
5' GCCGAGTCTGTTTCACGCCTGTCC 3' |||||||||||||||||||||||| 3' CGGCTCAGACAAAGTGCGGACAGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:130365098..130365121 24/24 Antisense target dnmt1.L
chr4S:22688492..22688515 21/24 Antisense off-target LOC108715325 [provisional:kcnc1]
Publications
First: Kaiso is a genome-wide repressor of transcription that is essential for amphibian development., Development 2004        
Most recent: xDnmt1 regulates transcriptional silencing in pre-MBT Xenopus embryos independently of its catalytic function., Development 2008  
View All Papers