Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249410

Morpholino Name: dvl1 MO1
Synonyms: Dvl1 Mo, Dvl1-Mo, Dvl1MO
mRNA Target: dvl1

Morpholino Type: uncategorized morpholino
Sequence:
5' GGTAGATGATTTTGGTCTCAGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' ATGGCTGAAACCAGAATCATCTACC 3' |||||||| |||| ||||||||||| 3' TACCGACTCTGGTTTTAGTAGATGG 5' 5' ATGGCTGAGACCAAAATCATCTACC 3' ||||||||||||||||||||||||| 3' TACCGACTCTGGTTTTAGTAGATGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr7L:86969475..86969499 25/25 unknown
chr7L:86974187..86974211 25/25 Antisense target dvl1.L
chr7S:61876584..61876608 25/25 Antisense off-target LOC108697641 [provisional:dvl1]
chr7S:61879436..61879460 25/25 unknown
chr3L:54389977..54390001 22/25 unknown
chr5S:93283627..93283651 21/25 unknown
chr9_10S:5540113..5540137 21/25 Sense off-target LOC108702556 [provisional:kansl1]
tropicalis 10.0 Chr7:93059528..93059552 25/25 Antisense target dvl1
Chr7:93065015..93065039 23/25 Antisense target dvl1
Publications
First: Dishevelled controls apical docking and planar polarization of basal bodies in ciliated epithelial cells., Nat Genet 2008        
Most recent: Developmentally regulated GTP-binding protein 1 modulates ciliogenesis via an interaction with Dishevelled., J Cell Biol 2019                
View All Papers