Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249412

Morpholino Name: dvl2 MO1
Synonyms: Dsh, Dvl2 Mo, Dvl2MO, XDSH MO, xDVL2-MO
mRNA Target: dvl2

Morpholino Type: uncategorized morpholino
Sequence:
5' TCACTTTAGTCTCCGCCATTCTGCG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' CGCAGGATGGCGGAGACTAAAGTCA 3' ||||| ||||||||||||||||| | 3' GCGTCTTACCGCCTCTGATTTCACT 5' 5' CGCAGAATGGCGGAGACTAAAGTGA 3' ||||||||||||||||||||||||| 3' GCGTCTTACCGCCTCTGATTTCACT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:143858628..143858652 25/25 Antisense target dvl2.L
chr3L:143930219..143930243 25/25 unknown
tropicalis 10.0 Chr3:153304088..153304112 23/25 Antisense target dvl2
Publications
First: Dishevelled activates Ca2+ flux, PKC, and CamKII in vertebrate embryos., J Cell Biol 2003              
Most recent: Sprouty2 regulates positioning of retinal progenitors through suppressing the Ras/Raf/MAPK pathway., Sci Rep 2020                        
View All Papers