Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249412

Morpholino Name: dvl2 MO1
Synonyms: Dsh, Dvl2 Mo, Dvl2MO, XDSH MO, Xdsh, XdshMO, xDVL2-MO
mRNA Target: dvl2

Morpholino Type: uncategorized morpholino
Sequence:
5' TCACTTTAGTCTCCGCCATTCTGCG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CGCAGAATGGCGGAGACTAAAGTGA 3' ||||||||||||||||||||||||| 3' GCGTCTTACCGCCTCTGATTTCACT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold206594:231..255 25/25 unknown
Scaffold272690:56799..56823 25/25 Antisense target dvl2.L
Publications
First: Dishevelled activates Ca2+ flux, PKC, and CamKII in vertebrate embryos., J Cell Biol 2003              
Most recent: TBC1d24-ephrinB2 interaction regulates contact inhibition of locomotion in neural crest cell migration., Nat Commun 2018    
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556