Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249414

Morpholino Name: dvl2 MO3
Synonyms: MODvl2
mRNA Target: dvl2

Morpholino Type: uncategorized morpholino
Sequence:
5' ATGACTTTAGTCTCCGCCATCCTGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' GCAGAATGGCGGAGACTAAAGTGAT 3' |||| ||||||||||||||||| || 3' CGTCCTACCGCCTCTGATTTCAGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold206594:230..254 23/25 unknown
Scaffold272690:56798..56822 23/25 Antisense target dvl2.L
Scaffold128772:338053..338077 21/25 Antisense off-target Xelaev16008048m
tropicalis 7.1 scaffold_2:150574851..150574875 21/25 unknown
Publications
First: Dishevelled limits Notch signalling through inhibition of CSL., Development 2012        
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556