Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249414

Morpholino Name: dvl2 MO3
Synonyms: MODvl2
mRNA Target: dvl2

Morpholino Type: uncategorized morpholino
Sequence:
5' ATGACTTTAGTCTCCGCCATCCTGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' GCAGGATGGCGGAGACTAAAGTCAT 3' ||||||||||||||||||||||||| 3' CGTCCTACCGCCTCTGATTTCAGTA 5' 5' GCAGAATGGCGGAGACTAAAGTGAT 3' |||| ||||||||||||||||| || 3' CGTCCTACCGCCTCTGATTTCAGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:143858627..143858651 23/25 Antisense target dvl2.L
chr3L:124651918..124651942 21/25 Antisense off-target Xelaev18018825m
chr3L:124651918..124651942 21/25 Sense off-target LOC108710340 [provisional:olfr139]
chr3L:143930220..143930244 23/25 unknown
tropicalis 10.0 Chr3:153304087..153304111 25/25 Antisense target dvl2
Chr3:3469012..3469036 21/25 Antisense off-target wnt7b
Publications
First: Dishevelled limits Notch signalling through inhibition of CSL., Development 2012        
Most recent:
View All Papers