Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249415

Morpholino Name: dvl3 MO1
Synonyms: Dvl3 Mo, Dvl3-Mo, Dvl3MO
mRNA Target: dvl3

Morpholino Type: uncategorized morpholino
Sequence:
5' GGTAGATGACCTTGGTCTCCCCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' ATGGGGGAGACCAAGGTCATCTACC 3' ||||||||||||||||||||||||| 3' TACCCCCTCTGGTTCCAGTAGATGG 5' 5' ATGGGGGAGACCAAGGTCATCTACC 3' ||||||||||||||||||||||||| 3' TACCCCCTCTGGTTCCAGTAGATGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold29016:1783931..1783955 25/25 Antisense off-target Xelaev16039212m
Scaffold84584:215997..216021 25/25 Antisense target dvl3.L
Scaffold25196:728100..728124 21/25 Sense off-target Xelaev16033790m
tropicalis 7.1 scaffold_5:10115422..10115446 25/25 Antisense target dvl3
Publications
First: Dishevelled controls apical docking and planar polarization of basal bodies in ciliated epithelial cells., Nat Genet 2008        
Most recent: Developmentally regulated GTP-binding protein 1 modulates ciliogenesis via an interaction with Dishevelled., J Cell Biol 2019                
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556