Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249415

Morpholino Name: dvl3 MO1
Synonyms: Dvl3 Mo, Dvl3-Mo, Dvl3MO
mRNA Target: dvl3

Morpholino Type: uncategorized morpholino
Sequence:
5' GGTAGATGACCTTGGTCTCCCCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' ATGGGGGAGACCAAGGTCATCTACC 3' ||||||||||||||||||||||||| 3' TACCCCCTCTGGTTCCAGTAGATGG 5' 5' ATGGGGGAGACCAAGGTCATCTACC 3' ||||||||||||||||||||||||| 3' TACCCCCTCTGGTTCCAGTAGATGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:98109000..98109024 25/25 Antisense target dvl3.L
chr5S:82221887..82221911 25/25 Antisense off-target LOC108718034 [provisional:dvl3]
chr5S:51828149..51828173 21/25 Sense off-target nid1.S
tropicalis 10.0 Chr5:100198440..100198464 25/25 Antisense target dvl3
Publications
First: Dishevelled controls apical docking and planar polarization of basal bodies in ciliated epithelial cells., Nat Genet 2008        
Most recent: Developmentally regulated GTP-binding protein 1 modulates ciliogenesis via an interaction with Dishevelled., J Cell Biol 2019                
View All Papers