Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249416

Morpholino Name: dvl3 MO2
Synonyms: Dvl3 Alternate MO
mRNA Target: dvl3

Morpholino Type: uncategorized morpholino
Sequence:
5' GGCTTAGCCCCAAAATCTGTCATAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' GTATGACAGATTTTGGGGCTAAGCC 3' ||||||||||||||||||||||||| 3' CATACTGTCTAAAACCCCGATTCGG 5' 5' GTATGACAGATTTTGGGGCTAAGCC 3' ||||||||||||||||||||||||| 3' CATACTGTCTAAAACCCCGATTCGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold84584:215911..215935 25/25 Antisense target dvl3.L
Scaffold29016:1784017..1784041 24/25 Antisense off-target Xelaev16039212m
Scaffold18892:5858942..5858966 21/25 unknown
tropicalis 7.1 scaffold_5:10115336..10115360 25/25 Antisense target dvl3
Publications
First: Dishevelled mediates ephrinB1 signalling in the eye field through the planar cell polarity pathway., Nat Cell Biol 2006  
Most recent: Distinct functionality of dishevelled isoforms on Ca2+/calmodulin-dependent protein kinase 2 (CamKII) in Xenopus gastrulation., Mol Biol Cell 2015              
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.3


Major funding for Xenbase is provided by grant P41 HD064556