Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249421

Morpholino Name: ebf2 MO1
Synonyms: Ebf2 MO, ebf2
mRNA Target: ebf2

Morpholino Type:
Sequence:
5' GCGCTTTGTCTCTCAAGGCAGTTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' GGAACTGCCTTGAGAGACAAAGCGC 3' ||||||||||||||||||||||||| 3' CCTTGACGGAACTCTCTGTTTCGCG 5' 5' GGAACTGCCTTGAGAGACAAAGCGC 3' ||||||||||||||||||||||||| 3' CCTTGACGGAACTCTCTGTTTCGCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold30425:242180-242204 25/25 Antisense target ebf2.S
Scaffold59755:440864-440888 25/25 Antisense off-target Xelaev16065227m
Scaffold51966:156126-156150 21/25 unknown
tropicalis 7.1 scaffold_3:9780478-9780502 25/25 Antisense target ebf2
Publications
First: Absence of heartbeat in the Xenopus tropicalis mutation muzak is caused by a nonsense mutation in cardiac myosin myh6. [Dev Biol 2009]
Most recent: EBF proteins participate in transcriptional regulation of Xenopus muscle development. [Dev Biol 2011]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556