Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249422

Morpholino Name: ebf3 MO1
Synonyms: Ebf3 MO, ebf3
mRNA Target: ebf3

Morpholino Type:
Sequence:
5' GTATATTTTCCTGAATCCCAAACAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold16863:6379799-6379823 25/25 Antisense off-target Xelaev16019882m
Scaffold252965:16-40 25/25 unknown
Scaffold7555:6475422-6475446 25/25 Antisense off-target Xelaev16072460m
Scaffold24467:2492504-2492528 22/25 unknown
Scaffold51452:4103066-4103090 22/25 unknown
Scaffold54336:459246-459270 22/25 Antisense off-target Xelaev16061967m
Scaffold84090:4050-4074 22/25 Antisense off-target Xelaev16075772m
Scaffold106782:2374088-2374112 21/25 Antisense off-target kank1.L
Scaffold185879:942139-942163 21/25 Sense off-target Xelaev16023017m
Scaffold221007:3084537-3084561 21/25 unknown
Scaffold325141:151947-151971 21/25 Sense off-target Xelaev16043009m
Scaffold3881:806754-806778 21/25 unknown
Scaffold47288:40154-40178 21/25 Sense off-target Xelaev16056593m
Scaffold86871:2096943-2096967 21/25 Antisense off-target Xelaev16076681m
tropicalis 7.1 scaffold_7:15996722-15996746 25/25 unknown
scaffold_222:48584-48608 22/25 unknown
scaffold_3:43876923-43876947 22/25 Antisense off-target ebf1
scaffold_3:92998128-92998152 21/25 Antisense off-target adamts20
scaffold_4:33449732-33449756 21/25 unknown
scaffold_7188:4036-4060 21/25 unknown
scaffold_9:6949984-6950008 21/25 unknown
Publications
First: Absence of heartbeat in the Xenopus tropicalis mutation muzak is caused by a nonsense mutation in cardiac myosin myh6. [Dev Biol 2009]
Most recent: EBF proteins participate in transcriptional regulation of Xenopus muscle development. [Dev Biol 2011]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556