Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249422

Morpholino Name: ebf3 MO1
Synonyms: Ebf3 MO, ebf3
Target mRNA: ebf3

Morpholino Type: uncategorized morpholino
Sequence: 5' GTATATTTTCCTGAATCCCAAACAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' ATGTTTGGGATTCAGGAAAATATAC 3' ||||||||||||||||||||||||| 3' TACAAACCCTAAGTCCTTTTATATG 5' 5' ATGTTTGGGATTCAGGAAAATATAC 3' ||||||||||||||||||||||||| 3' TACAAACCCTAAGTCCTTTTATATG 5' 5' ATGTTTGGGATTCAGGAAAATATAC 3' ||||||||||||||||||||||||| 3' TACAAACCCTAAGTCCTTTTATATG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr7L:17046708..17046732 25/25 Antisense target ebf3.L
chr7S:13039387..13039411 25/25 Antisense target ebf3.S
chr1S:169294833..169294857 22/25 Sense off-target ccbe1.S
chr1S:58974922..58974946 22/25 Antisense off-target fabp2.S
chr3L:6500257..6500281 22/25 Antisense off-target LOC108710765 [provisional:ebf1]
chr3S:10874833..10874857 22/25 Antisense off-target LOC108712602 [provisional:ebf1]
chr1L:127039873..127039897 21/25 Antisense off-target kank1.L
chr1L:48563368..48563392 21/25 Sense off-target fbxw7.L
chr1S:109281486..109281510 21/25 Antisense off-target frmd3.S
chr1S:99238933..99238957 21/25 Sense off-target mob3b.S
chr4L:79470282..79470306 21/25 Sense off-target st3gal-iii
chr2S:109038001..109038025 21/25 unknown
chr2S:20835613..20835637 21/25 unknown
tropicalis 10.0 Chr7:22304971..22304995 25/25 Antisense target ebf3
Chr3:13561200..13561224 22/25 Antisense off-target ebf4
Chr1:216295920..216295944 21/25 Antisense off-target LOC101730472
Chr3:64498724..64498748 21/25 Antisense off-target adamts20
Chr6:74857928..74857952 21/25 Antisense off-target mocos
Chr1:216293608..216293632 21/25 Antisense off-target LOC101730472
Chr2:151446663..151446687 21/25 unknown
Chr4:44869896..44869920 21/25 unknown
Chr5:97380184..97380208 21/25 unknown
Publications
First: Absence of heartbeat in the Xenopus tropicalis mutation muzak is caused by a nonsense mutation in cardiac myosin myh6., Dev Biol 2009              
Most recent: EBF proteins participate in transcriptional regulation of Xenopus muscle development., Dev Biol 2011                      
View All Papers