Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249423

Morpholino Name: edil3 MO1
Synonyms: Del1-MO
mRNA Target: edil3

Morpholino Type: uncategorized morpholino
Sequence:
5' GACCCCCTTTAGGATCATGCTTGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold1187:7814580..7814603 24/24 Antisense off-target Xelaev16004916m
Scaffold32212:1534319..1534342 24/24 Antisense off-target Xelaev16042775m
Publications
First: Anterior neural development requires Del1, a matrix-associated protein that attenuates canonical Wnt signaling via the Ror2 pathway., Development 2010              
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556