Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249425

Morpholino Name: edil3 MO3
Synonyms: MO-B
mRNA Target: edil3

Morpholino Type: uncategorized morpholino
Sequence:
5' TTCTAGGCGTGGCTGAGTGCTGTGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold1187:7814186..7814210 25/25 Antisense off-target Xelaev16004916m
Scaffold24077:27..51 25/25 unknown
Scaffold32212:1533930..1533954 25/25 unknown
tropicalis 7.1 scaffold_1:27850751..27850775 24/25 unknown
Publications
First: The secreted EGF-Discoidin factor xDel1 is essential for dorsal development of the Xenopus embryo., Dev Biol 2007                      
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556