Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249426

Morpholino Name: edn3 MO1
Synonyms: ET3MO
mRNA Target: edn3

Morpholino Type:
Sequence:
5' GCTCCATGAACCCCCAATGAGAAGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GCTTCTCATTGGGGGTTCATGGAGC 3' ||||||||||||||||||||||||| 3' CGAAGAGTAACCCCCAAGTACCTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold103958:37911..37935 25/25 Antisense off-target Xelaev16001070m
Scaffold13471:4729094..4729118 25/25 unknown
Scaffold102974:21106898..21106922 21/25 unknown
tropicalis 7.1 scaffold_10:23457698..23457722 25/25 Antisense target edn3
scaffold_2:60884823..60884847 21/25 Antisense off-target mgat4b
scaffold_5:4484359..4484383 21/25 unknown
Publications
First: ET3/Ednrb2 signaling is critically involved in regulating melanophore migration in Xenopus. [Dev Dyn 2011]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.0
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556