Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249427

Morpholino Name: ednra MO1
Synonyms: EdnraMO
mRNA Target: ednra

Morpholino Type:
Sequence:
5' CAAGGTGTTTCCTCCCATCCTGATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25 25/25 22/25
genomic

MO
5' AATCAGGATGGGAGGCGACATCTTG 3' |||||||||||||| ||| |||| 3' GTAGTCCTACCCTCCTTTGTGGAAC 5' 5' CATCAGGATGGGAGGAAACACCTTG 3' ||||||||||||||||||||||||| 3' GTAGTCCTACCCTCCTTTGTGGAAC 5' 5' AATCAAGATGGGAGGAAACATCTTG 3' |||| |||||||||||||| |||| 3' GTAGTCCTACCCTCCTTTGTGGAAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold47288:2138297..2138321 25/25 Antisense target ednra.L
Scaffold99286:3394922..3394946 22/25 Antisense target ednra.S
Scaffold4321:622441..622465 21/25 Sense off-target Xelaev16052892m
tropicalis 7.1 scaffold_1:167026974..167026998 21/25 Antisense target ednra
Publications
First: A new role for the Endothelin-1/Endothelin-A receptor signaling during early neural crest specification. [Dev Biol 2008]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556