Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249428

Morpholino Name: eef1a2 MO1
Synonyms: MO-eEF1A2
mRNA Target: eef1a2

Morpholino Type:
Sequence:
5' ATGTGTGTCTTCTCTTTCCCCATCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' GGATGGGGAAAGAGAAGACACACAT 3' ||||||||||||||||||||||||| 3' CCTACCCCTTTCTCTTCTGTGTGTA 5' 5' GGATGGGGAAAGAGAAGACACACAT 3' ||||||||||||||||||||||||| 3' CCTACCCCTTTCTCTTCTGTGTGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold18670:188791-188815 25/25 Antisense off-target Xelaev16023116m
Scaffold254613:702406-702430 25/25 Antisense target eef1a2.S
Scaffold150750:156396-156420 21/25 unknown
Scaffold33269:870887-870911 21/25 unknown
tropicalis 7.1 scaffold_10:37846044-37846068 25/25 Antisense target eef1a2
scaffold_5:80159126-80159150 22/25 Antisense off-target igf2r
scaffold_1:18671033-18671057 21/25 Sense off-target lman1
scaffold_6:118719992-118720016 21/25 Antisense off-target spag6
scaffold_6:131697090-131697114 21/25 unknown
scaffold_6:131701440-131701464 21/25 unknown
scaffold_6:131713093-131713117 21/25 unknown
scaffold_6:131717317-131717341 21/25 unknown
scaffold_7:123685256-123685280 21/25 unknown
scaffold_7:31890011-31890035 21/25 Sense off-target ide
Publications
First: Tumor suppressor p16(INK4a) inhibits cancer cell growth by downregulating eEF1A2 through a direct interaction. [J Cell Sci 2013]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556