Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249429

Morpholino Name: efna1 MO1
Synonyms: Xephrin-A1 MO
mRNA Target: efna1

Morpholino Type: uncategorized morpholino
Sequence:
5' CCGCCGCTCTGTACAACTCCATCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold154892:226462..226486 25/25 unknown
tropicalis 7.1 scaffold_3:66776717..66776741 21/25 unknown
Publications
First: The involvement of Eph-Ephrin signaling in tissue separation and convergence during Xenopus gastrulation movements., Dev Biol 2011                            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556