Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249430

Morpholino Name: efnb1 MO1
Synonyms: ephrinB1 morpholino
mRNA Target: efnb1

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' GGAGCCCTTCCATCCGCACAGGTGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CCACCTGTGCGGATGGAAGGGCTCC 3' ||||||||||||||||||||||||| 3' GGTGGACACGCCTACCTTCCCGAGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold36991:2640450..2640474 25/25 Antisense target efnb1.L
tropicalis 7.1 scaffold_28:30951..30975 24/25 unknown
scaffold_9:84386032..84386056 21/25 unknown
Publications
First: Morphogenetic movements underlying eye field formation require interactions between the FGF and ephrinB1 signaling pathways., Dev Cell 2004                
Most recent: PDGF-A suppresses contact inhibition during directional collective cell migration., Development 2018                      
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556