Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249431

Morpholino Name: efnb2 MO1
Synonyms: B2MO, ephrinB2
mRNA Target: efnb2

Morpholino Type: uncategorized morpholino
Sequence:
5' ACACCGAGTCCCCGCTCAGTGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' ATGGCACTGAGCGGGGACTCGGTGT 3' ||||||||||||||||||||||||| 3' TACCGTGACTCGCCCCTGAGCCACA 5' 5' ATGGCACTGAGCGGGGACTCGGTGT 3' ||||||||||||||||||||||||| 3' TACCGTGACTCGCCCCTGAGCCACA 5' 5' ATGGCACTGAGCGGGGACTCGGTGT 3' ||||||||||||||||||||||||| 3' TACCGTGACTCGCCCCTGAGCCACA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold167628:2290838..2290862 25/25 Antisense target efnb2.S
Scaffold44780:1672655..1672679 25/25 Antisense target efnb2.L
tropicalis 7.1 scaffold_2:96755275..96755299 25/25 Antisense target efnb2
Publications
First: A molecular base for cell sorting at embryonic boundaries: contact inhibition of cadherin adhesion by ephrin/ Eph-dependent contractility., Dev Cell 2013  
Most recent: PDGF-A suppresses contact inhibition during directional collective cell migration., Development 2018                      
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556