Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249433

Morpholino Name: egfl7 MO2
Synonyms: egfl7 MO
mRNA Target: egfl7

Morpholino Type: uncategorized morpholino
Sequence:
5' ACAGCACTAAAGAGAGAGACACAAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold37448:2751445..2751469 25/25 Antisense off-target Xelaev16048920m
Scaffold1168:2741916..2741940 22/25 unknown
Scaffold12518:13597984..13598008 22/25 unknown
Scaffold193525:388171..388195 22/25 unknown
Scaffold198991:446451..446475 22/25 unknown
Scaffold7940:177133..177157 22/25 unknown
Scaffold16807:1135100..1135124 21/25 unknown
Scaffold30470:5412643..5412667 21/25 unknown
Scaffold35184:1315948..1315972 21/25 Antisense off-target atxn7.L
Scaffold50694:328325..328349 21/25 unknown
Scaffold8276:651230..651254 21/25 Sense off-target Xelaev16075359m
tropicalis 7.1 scaffold_3:56645455..56645479 21/25 unknown
scaffold_442:44746..44770 21/25 unknown
scaffold_6:120490301..120490325 21/25 Sense off-target abi1
scaffold_6:141091092..141091116 21/25 unknown
scaffold_8:83548337..83548361 21/25 Antisense off-target atg14
Publications
First: CASZ1 promotes vascular assembly and morphogenesis through the direct regulation of an EGFL7/RhoA-mediated pathway., Dev Cell 2013          
Most recent: A distinct mechanism of vascular lumen formation in Xenopus requires EGFL7., PLoS One 2015              
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556