Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249447

Morpholino Name: eomes MO1
Synonyms:
mRNA Target: eomes

Morpholino Type: uncategorized morpholino
Sequence:
5' GAACATCCTCCTGCAAAGCAAAGAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GTCTTTGCTTTGCAGGAGGATGTTC 3' ||||||||||||||||||||||||| 3' CAGAAACGAAACGTCCTCCTACAAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold48114:949338..949362 24/25 Antisense off-target Xelaev16057486m
Scaffold69258:1515764..1515788 22/25 Antisense off-target eomes.S
Scaffold30483:1014755..1014779 21/25 unknown
Scaffold338514:215015..215039 21/25 Antisense off-target Xelaev16044615m
Scaffold51452:2757810..2757834 21/25 unknown
tropicalis 7.1 scaffold_6:97453070..97453094 25/25 Antisense target eomes
scaffold_2:149754910..149754934 22/25 Antisense off-target tbx15
Publications
First: Zygotic VegT is required for Xenopus paraxial mesoderm formation and is regulated by Nodal signaling and Eomesodermin., Int J Dev Biol 2010                
Most recent: High-resolution analysis of gene activity during the Xenopus mid-blastula transition., Development 2014                    
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556