Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249447

Morpholino Name: eomes MO1
Synonyms:
Target mRNA: eomes

Morpholino Type: uncategorized morpholino
Sequence: 5' GAACATCCTCCTGCAAAGCAAAGAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 22/25
genomic

MO
5' GTCTTTGCTTTGCAGGAGGATGTTC 3' ||||||||||||||||||||||||| 3' CAGAAACGAAACGTCCTCCTACAAG 5' 5' GTTTTTGCTTTGCAGGAGGATGTTC 3' || |||||||||||||||||||||| 3' CAGAAACGAAACGTCCTCCTACAAG 5' 5' GTCTTTGTTTTACAGGAGGATGTTT 3' ||||||| ||| |||||||||||| 3' CAGAAACGAAACGTCCTCCTACAAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:46153160..46153184 24/25 Antisense target eomes.L
chr6S:39833033..39833057 22/25 Antisense target eomes.S
chr1S:167949577..167949601 21/25 Sense off-target slc45a2.S
chr2L:1586279..1586303 21/25 Antisense off-target tbx15.L
chr4L:31693435..31693459 21/25 Antisense off-target fto.L
tropicalis 10.0 Chr6:48271342..48271366 25/25 Antisense target eomes
Chr2:2142650..2142674 22/25 Antisense off-target tbx15
Publications
First: Zygotic VegT is required for Xenopus paraxial mesoderm formation and is regulated by Nodal signaling and Eomesodermin., Int J Dev Biol 2010                
Most recent: The Spatiotemporal Control of Zygotic Genome Activation., iScience 2019                            
View All Papers