Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249448

Morpholino Name: eomes MO2
Synonyms:
Target mRNA: eomes

Morpholino Type: uncategorized morpholino
Sequence: 5' TGCGCGGCACCCACCTTGCATATTA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 21/25
genomic

MO
5' TAATATGCAAGGTGGGTGCCGCGCA 3' ||||||||||||||||||||||||| 3' ATTATACGTTCCACCCACGGCGCGT 5' 5' CAATATGCAAGGTGGGTACGGCGCT 3' |||||||||||||||| | |||| 3' ATTATACGTTCCACCCACGGCGCGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:46153001..46153025 21/25 Antisense target eomes.L
chr4L:35697672..35697696 22/25 unknown
tropicalis 10.0 Chr6:48271183..48271207 25/25 Antisense target eomes
Publications
First: Zygotic VegT is required for Xenopus paraxial mesoderm formation and is regulated by Nodal signaling and Eomesodermin., Int J Dev Biol 2010                
Most recent: High-resolution analysis of gene activity during the Xenopus mid-blastula transition., Development 2014                    
View All Papers