Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249452

Morpholino Name: epha4 MO1
Synonyms: A4MO, EphA4
Target mRNA: epha4

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' AGATGCCATGTACAATCCCAGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 24/25
genomic

MO
5' ATGGCTGGGATTGTACATGGCATCT 3' ||||||||||||||||||||||||| 3' TACCGACCCTAACATGTACCGTAGA 5' 5' ATGGCTGGGATTGTACATGGCATCT 3' ||||||||||||||||||||||||| 3' TACCGACCCTAACATGTACCGTAGA 5' 5' ATGGCTGGGATTGTACATGGCGTCT 3' ||||||||||||||||||||| ||| 3' TACCGACCCTAACATGTACCGTAGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:122785434..122785458 25/25 Antisense target epha4.L
chr5S:105701030..105701054 24/25 Antisense target epha4.S
chr1S:29272041..29272065 21/25 unknown
tropicalis 10.0 Chr5:124791774..124791798 25/25 Antisense target epha4
Chr2:102543923..102543947 21/25 unknown
Publications
First: A molecular base for cell sorting at embryonic boundaries: contact inhibition of cadherin adhesion by ephrin/ Eph-dependent contractility., Dev Cell 2013  
Most recent: Sorting at embryonic boundaries requires high heterotypic interfacial tension., Nat Commun 2017                                        
View All Papers