Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249453

Morpholino Name: epha4 MO2
Synonyms: XEphA4 MO, XEphA4MO
Target mRNA: epha4

Morpholino Type: uncategorized morpholino
Sequence: 5' CGGAGGTGGATTAAGAGATGCCTAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 22/25
genomic

MO
5' ATAGGCATCTCTTAATCCACCTCCG 3' ||||||||||||||||||||||||| 3' TATCCGTAGAGAATTAGGTGGAGGC 5' 5' ACAGGCATCTCTTCATCCACCTCCA 3' | ||||||||||| |||||||||| 3' TATCCGTAGAGAATTAGGTGGAGGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:122785479..122785503 25/25 Antisense target epha4.L
chr5S:105701075..105701099 22/25 Antisense target epha4.S
chr6L:10167696..10167720 21/25 unknown
chr7S:73217791..73217815 21/25 unknown
tropicalis 10.0 Chr1:180576111..180576135 22/25 Antisense off-target edil3
Publications
First: The involvement of Eph-Ephrin signaling in tissue separation and convergence during Xenopus gastrulation movements., Dev Biol 2011                            
Most recent: EphA4-dependent Brachyury expression is required for dorsal mesoderm involution in the Xenopus gastrula., Development 2014                                
View All Papers