Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249454

Morpholino Name: eps15l1 MO1
Synonyms: Eps15R MO
mRNA Target: eps15l1

Morpholino Type:
Sequence:
5' TGAGAGGGATGAGCGCCGCCATCTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AAGATGGCGGCGCTCATCCCTCTCA 3' ||||||||||||||||||||||||| 3' TTCTACCGCCGCGAGTAGGGAGAGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold357348:586282..586306 25/25 Antisense off-target Xelaev16046813m
Scaffold90041:5848888..5848912 25/25 Antisense off-target Xelaev16078071m
Scaffold102974:8505551..8505575 22/25 unknown
Scaffold106735:436656..436680 22/25 unknown
Scaffold23301:5109602..5109626 22/25 unknown
Scaffold48253:3955407..3955431 22/25 Antisense off-target Xelaev16057592m
Scaffold7103:2848828..2848852 22/25 unknown
Scaffold74339:1107325..1107349 22/25 unknown
Scaffold27161:3759430..3759454 21/25 Sense off-target Xelaev16037072m
Scaffold343860:21396..21420 21/25 Antisense off-target Xelaev16044934m
Scaffold52441:5381681..5381705 21/25 unknown
tropicalis 7.1 scaffold_1:129114684..129114708 25/25 Antisense target eps15l1
Publications
First: Eps15R is required for bone morphogenetic protein signalling and differentially compartmentalizes with Smad proteins. [Open Biol 2012]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556