Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249455

Morpholino Name: erbb4 MO1
Synonyms: ErbB4-MO
mRNA Target: erbb4

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence:
5' TTCCCTCCAAAAACTCTGGATCTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold13787:2332929..2332953 25/25 unknown
Scaffold26505:2780595..2780619 21/25 unknown
Scaffold55571:1791330..1791354 21/25 unknown
tropicalis 7.1 scaffold_6:92212650..92212674 22/25 Antisense off-target ulk4
scaffold_9:70121851..70121875 21/25 unknown
Publications
First: Regulation of Xenopus gastrulation by ErbB signaling., Dev Biol 2007                      
Most recent: PI3K and Erk MAPK mediate ErbB signaling in Xenopus gastrulation., Mech Dev 2007                      
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556