Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249456

Morpholino Name: erf MO1
Synonyms: Erf #1
Target mRNA: erf

Morpholino Type: uncategorized morpholino
Sequence: 5' CCACTAGCGCTGCTCTCCCCTCGGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 22/25 25/25
genomic

MO
5' ACCGAGGGGAGAGCAGCGCCAGTGG 3' ||||||||||||||||||| ||||| 3' TGGCTCCCCTCTCGTCGCGATCACC 5' 5' ACCGAGGGGAGAACAGCGCCAGCGG 3' |||||||||||| |||||| || || 3' TGGCTCCCCTCTCGTCGCGATCACC 5' 5' ACCGAGGGGAGAGCAGCGCTAGTGG 3' ||||||||||||||||||||||||| 3' TGGCTCCCCTCTCGTCGCGATCACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr7S:75288057..75288081 25/25 Antisense target erf.S
chr7L:102178453..102178477 22/25 Antisense target erf.L
tropicalis 10.0 Chr7:107392844..107392868 24/25 Antisense target erf
Chr2:64550846..64550870 21/25 Antisense off-target nfasc
Publications
First: ERF and ETV3L are retinoic acid-inducible repressors required for primary neurogenesis., Development 2013                                                                
Most recent:
View All Papers