Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249457

Morpholino Name: erf MO2
Synonyms: Erf #2
Target mRNA: erf

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTCTGTGCTGCTTCTCCTCCTCCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 22/25 25/25
genomic

MO
5' GGGAGGAGGAGAAGCAGCACAGACC 3' |||||||||||||||||||||||| 3' ACCTCCTCCTCTTCGTCGTGTCTGG 5' 5' CCGAGGAGGAGAAGCTGCACAGACC 3' ||||||||||||| ||||||||| 3' ACCTCCTCCTCTTCGTCGTGTCTGG 5' 5' TGGAGGAGGAGAAGCAGCACAGACC 3' ||||||||||||||||||||||||| 3' ACCTCCTCCTCTTCGTCGTGTCTGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr7S:75288092..75288116 25/25 Antisense target erf.S
chr7L:102178488..102178512 22/25 Antisense target erf.L
chr3S:76530210..76530234 21/25 Sense off-target grm8.S
chr4L:135492693..135492717 21/25 Antisense off-target pdzrn3.L
chr6L:77475261..77475285 21/25 Antisense off-target cdh12.L
chr7L:97014753..97014777 21/25 Sense off-target ttc34.L
chr7L:97014753..97014777 21/25 Antisense off-target LOC108696632
Scaffold24:3085673..3085697 21/25 Antisense off-target ptpdc1.L
Scaffold68:345191..345215 21/25 unknown
chr1L:45710251..45710275 21/25 unknown
chr1S:80197576..80197600 21/25 unknown
chr8L:48887054..48887078 21/25 unknown
tropicalis 10.0 Chr7:107392879..107392903 24/25 Antisense target erf
Chr3:42143792..42143816 21/25 Sense off-target sfxn1
Chr4:45962109..45962133 21/25 unknown
Chr9:71912834..71912858 21/25 unknown
Publications
First: ERF and ETV3L are retinoic acid-inducible repressors required for primary neurogenesis., Development 2013                                                                
Most recent:
View All Papers