Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249469

Morpholino Name: ets2 MO1
Synonyms: Ets-2
Target mRNA: ets2

Morpholino Type: uncategorized morpholino
Sequence: 5' AGCTGAGGGAGGGTATGTCCTTCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/24
genomic

MO
5' GGAAGGACATACCCTCCCTCAGCT 3' |||||||||||||||||||||||| 3' CCTTCCTGTATGGGAGGGAGTCGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2L:11081875..11081898 24/24 Antisense target ets2.L
chr5L:41813557..41813580 21/24 Antisense off-target rdh13.L
chr7L:54083197..54083220 20/24 unknown
tropicalis 10.0 Chr5:112835403..112835426 20/24 Antisense off-target LOC105947301
Chr5:112835403..112835426 20/24 Sense off-target LOC101731180
Chr9:344747..344770 21/24 unknown
Publications
First: Essential role of the transcription factor Ets-2 in Xenopus early development., J Biol Chem 2003              
Most recent:
View All Papers