Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249470

Morpholino Name: etv1 MO1
Synonyms: etv1 MO
Target mRNA: etv1

Morpholino Type: uncategorized morpholino
Sequence: 5' CTTGCTGGTCATAAAATCCATCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' ATGGATGGATTTTATGACCAGCAAG 3' ||||||||||||||||||||||||| 3' TACCTACCTAAAATACTGGTCGTTC 5' 5' ATGGATGGATTTTATGACCAGCAAG 3' ||||||||||||||||||||||||| 3' TACCTACCTAAAATACTGGTCGTTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6S:28402852..28402876 25/25 Antisense target etv1.S
chr6L:33982261..33982285 25/25 Antisense off-target etv4.L
chr9_10S:86078524..86078548 22/25 Sense off-target micall2.S
chr2L:168835844..168835868 21/25 Sense off-target LOC108708756 [provisional:fat3]
chr4L:91855045..91855069 21/25 Antisense off-target LOC108714364 [provisional:adamtsl2]
chr5S:62004946..62004970 21/25 unknown
tropicalis 10.0 Chr6:36296701..36296725 25/25 Antisense target etv1
Chr4:65086443..65086467 22/25 Sense off-target gse1
Chr5:18602742..18602766 21/25 unknown
Publications
First: The ETS transcription factor Etv1 mediates FGF signaling to initiate proneural gene expression during Xenopus laevis retinal development., Mech Dev 2014        
Most recent:
View All Papers