Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249472

Morpholino Name: etv2 MO2
Synonyms: evt2 MO2
Target mRNA: etv2

Morpholino Type: uncategorized morpholino
Sequence: 5' CGCGACAGGCTCTGCTTGCACCAAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 21/25
genomic

MO
5' TTTGGTGCAAGCAGAGCCTGTCCCG 3' |||||||||||||||||||||| || 3' AAACCACGTTCGTCTCGGACAGCGC 5' 5' ATTGGTGCAAGCGGAGCCTGTCCCA 3' ||||||||||| ||||||||| | 3' AAACCACGTTCGTCTCGGACAGCGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr7L:122109291..122109315 24/25 Antisense target etv2.L
chr7S:87475451..87475475 21/25 Antisense target etv2.S
Publications
First: ETS family protein ETV2 is required for initiation of the endothelial lineage but not the hematopoietic lineage in the Xenopus embryo., Dev Dyn 2010                              
Most recent: Annexin A3 Regulates Early Blood Vessel Formation., PLoS One 2015              
View All Papers