Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249476

Morpholino Name: eya1 MO1
Synonyms: Eya1MO1
mRNA Target: eya1

Morpholino Type: uncategorized morpholino
Sequence:
5' TACTATGTGGACTGGTTAGATCCTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' CAGGATCTAGCCAGTCCACATAGTA 3' ||||||||| ||||||||||||||| 3' GTCCTAGATTGGTCAGGTGTATCAT 5'
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 7.1 scaffold_6:29198665..29198689 24/25 Antisense target eya1
Publications
First: Eya1 and Six1 promote neurogenesis in the cranial placodes in a SoxB1-dependent fashion., Dev Biol 2008                    
Most recent: A gene regulatory network underlying the formation of pre-placodal ectoderm in Xenopus laevis., BMC Biol 2018                              
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556